Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ-KIAA1244 | |||
Gene | KIAA1244 | Organism | Human |
Genome Locus | Build | hg19 | |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | PMID | 30236115 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | 0 GC patients with different TNM stages and 5 healthy individuals as controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAGTTACGACAGAGGCAGGA ReverseCAGCAGGCATTTCTCCTTTATG | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Tang, W, Fu, K, Sun, H, Rong, D, Wang, H, Cao, H (2018). CircRNA microarray profiling identifies a novel circulating biomarker for detection of gastric cancer. Mol. Cancer, 17, 1:137. |